SAP-Exo Kit
For general laboratory use.
Description:
The Kit contains two hydrolytic enzymes, recombinant Shrimp Alkaline Phosphatase (rSAP) and Exonuclease I (Exo I). The combination of these enzymes ensures complete dephosphorylation of dNTPs and degradation of residual primers, enabling downstream applications, such as sequencing, genotyping, cloning or SNP analysis. The reagents are active in commonly used PCR buffers and eliminates the need for additional buffer exchange.
Shipping: shipped on gel packs
Storage Conditions: store at -20 °C
avoid freeze/thaw cycles
Shelf Life: 12 months
Applications:
SAP-Exo Kit is a quick, easy and reliable enzymatic cleanup reagent for PCR product cleanup.
- Removes excess primers and dNTPs
- Fast 20 minute protocol
- Add directly to PCR product
- 100 % Sample Recovery
- Scalable for different reaction sizes
- No interference on downstream applications
- Easy to automate
Content:
SAP-Exo Mix (red cap)
Protocol:
- Add 2 μl of SAP-Exo mix directly to 5 μl PCR product (or scale up, e.g. 4 μl SAP-Exo mix to 10 μl PCR product) and mix well
- Incubate for 10 minutes at 37 °C
- Inactivate for 10 minutes at 80 °C
PCR products are ready for downstream applications without any need for further processing.
Related products:
| Cat. No. | Amount | Price |
|---|---|---|
| PP-218S | 500 μl | 175,80 € |
| PP-218L | 5 x 500 μl | 703,00 € |
At this point, external content from bioz.com is embedded. When it loads, data (e.g. your IP address) is transmitted to the provider.
Scientific citations for Jena Bioscience pp-218
34 scientific citations and 0 citation images found by Bioz.
-
Zoonotic dermatophyte Trichophyton erinacei in pet hedgehogs: sampling methodology and further insight into genetic diversity
Frontiers in Veterinary Science, 2026-07-01 · PMID:42459538
.. (CTTGGTCATTTAGAGGAAGTAA) and NL4 (GGTCCGTGTTTCAAGACGG), following the protocol described by Hubka et al. ( ).. PCR amplicons were purified with
EXOSAP (PP-218 LJena Bioscience , Jena, Germany) and sequenced using both terminal primers by Sanger sequencing Bioanalyzer 2100 (Agilent, Santa Clara, USA) at BIOCEV, Czech Republic.. The sequences were inspected and assembled using Bioedit v. 7.2.5 ( https://bioedit.software.informer.com/2/ ).The sequences .. -
Idiomarina solivarensis sp. nov., halophilic bacterium isolated from brine of the former subsurface salt mine in Solivar (Slovakia) showing a unique fatty acids profile.
Archives of microbiology, 2026-06-16 · PMID:42301321
.. cycling conditions and the reaction mixture were used as in Nosalova et al. (2021).. The amplicons obtained were then purified using
SAP Exokit (Jena Bioscience , Germany) and sequenced using Sanger sequencing method at Eurofins Genomics (Germany).. The obtained sequences were processed using the MEGA v12 software (Kumar et al. 2024).The .. -
Supplementary description and molecular analysis of Stiphodon hadiatyae (Teleostei, Gobioidei, Sicydiinae) from Enggano Island, Indonesia.
ZooKeys, 2026-03-05 · PMID:41782891
The thermal cycling profile for COI followed Liao et al. (2021) and consisted of 94 °C for 5 min; 37 cycles of 94 °C for 60 s, 60 °C for 45 s, and 72 °C for 60 s; and a final extension at 72 °C for 10 min. PCR products were checked by agarose gel electrophoresis, purified using the
SAP–Exo purification kit (Jena Bioscience , Jena, Germany), and then commercially Sanger-sequenced.
