AP3G (A cap) - Solution
For research use only.
Please centrifuge briefly before opening (volume ≤2 ml).
Shipping: shipped on gel packs
Storage Conditions: store at -20 °C
Short term exposure (up to 1 week cumulative) to ambient temperature possible.
Shelf Life: 12 months after date of delivery
Molecular Formula: C20H27N10O17P3 (free acid)
Molecular Weight: 772.41 g/mol (free acid)
Exact Mass: 772.08 g/mol (free acid)
Purity: ≥ 95 % (HPLC)
Form: solution in water
Color: colorless to slightly yellow
Concentration: 100 mM - 110 mM
pH: 7.5 ±0.5
Spectroscopic Properties: λ 259 nm, ε 27.0 L mmol-1 cm-1 (Tris-HCl pH 7.5)
Applications:
Synthesis of mRNA with a non-functional cap analog (ApppG) to estimate the level of cap-independent translation.[1]
Investigation of stress related (Near UV and oxidation) product formation in bacteria[2-4]
Selected References:
[1] Nowakowska et al. (2014) Cap analogs containing 6-thioguanosine--reagents for the synthesis of mRNAs selectively photo-crosslinkable with cap-binding biomolecules. Org. Biomol. Chem. 12 (27):4841.
[2] Kramer et al. (1988) Near-UV stress in Salmonella typhimurium: 4-thiouridine in tRNA, ppGpp, and ApppGpp as components of an adaptive response. J. Bacteriol. 170 (5):2344.
[3] Bochner et al. (1984) AppppA and related adenylylated nucleotides are synthesized as a consequence of oxidation stress. Cell 37 (1):225.
[4] VanBogelen et al. (1987) Differential induction of heat shock, SOS, and oxidation stress regulons and accumulation of nucleotides in Escherichia coli. J. Bacteriol. 169 (1):26.
| Cat. No. | Amount | Price |
|---|---|---|
| NU-941S | 10 μl (100 mM) | 78,80 € |
| NU-941L | 5 x 10 μl (100 mM) | 354,00 € |
At this point, external content from bioz.com is embedded. When it loads, data (e.g. your IP address) is transmitted to the provider.
Scientific citations for Jena Bioscience nu-941-sol
2 scientific citations and 0 citation images found by Bioz.
-
The Cap-Independent Translation of Survivin 5'UTR and HIV-1 IRES Sequences Is Inhibited by Oxidative Stress Produced by H. pylori Gamma-Glutamyl Transpeptidase Activity.
Biomolecules, 2026-01-28 · PMID:41594703
.. primer T7-SurvS-F 5′- AGTACTTAATACGACTCACTATAGCGGCGCGCCATTAACCGCCAGATTTG-3′along with the reverse primer T7-SVPolA-R 5′-TACCACATTTGTAGAGGTTTTACTTGCTTT-3′.. Acapped RNAs were obtained by replacing the 2× NTP/CAP buffer of mMESSAGE mMACHINETM T7 Transcription Kit with a similar mixture including 15 mM ATP, 15 mM CTP, 15 mM UTP, 3 mM GTP, and
12 mM of thenon-functional cap analog AP3G (Jena Bioscience , Jena, Germany). -
Splicing modulators elicit global translational repression by condensate-prone proteins translated from introns
bioRxiv, 2020-11-23 · DOI:10.1101/2020.11.23.393835
PrePrint: .. the DNA fragment was PCR-amplified from psiCHECK2-HCV-FL with the following primers: 5′-TGACTAATACGACTCACTATAGG-3′ and 5′-TGTATCTTATCATGTCTGCTCGAAG-3′.. AP
3 G (A-cap) (Jena Bioscience ) was added to the in vitro transcription reaction, skipping the capping reaction.
