AP4G
For research use only.
Please centrifuge briefly before opening (volume ≤2 ml).
Shipping: shipped on gel packs
Storage Conditions: store at -20 °C
Short term exposure (up to 1 week cumulative) to ambient temperature possible.
Shelf Life: 12 months after date of delivery
Molecular Formula: C20H28N10O20P4 (free acid)
Molecular Weight: 852.39 g/mol (free acid)
Exact Mass: 852.04 g/mol (free acid)
CAS#: 10527-46-5
Purity: ≥ 95 % (HPLC)
Form: solution in water
Color: colorless to slightly yellow
Concentration: 10 mM - 11 mM
pH: 7.5 ±0.5
Spectroscopic Properties: λmax 259 nm, ε 27.0 L mmol-1 cm-1 (Tris-HCl pH 7.5)
Applications:
Formation by T4 RNA ligase[1]
Formation by Pfu DNA ligase[2]
Acceptor substrate for T4 RNA ligase[3]
Selected References:
[1] Sillero et al. (2006) Synthesis of bisphosphonate derivatives of ATP by T4 RNA ligase. FEBS Lett. 580 (24):5723.
[2] Günther et al. (2002) Thermostable Pyrococcus furiosus DNA ligase catalyzes the synthesis of (di)nucleoside polyphosphates. Extremophiles. 6 (1):45.
[3] Atencia et al. (2000) Several dinucleoside polyphosphates are acceptor substrates in the T4 RNA ligase catalyzed reaction. Eur. J. Biochem. 267 (6):1707.
Winward et al. (2010) Oxidation of the diphosphoinositol polyphosphate phosphohydrolase-like Nudix hydrolase Aps from Drosophila melanogaster induces thermolability--A possible regulatory switch? Int. J. Biochem. Cell Biol. 42 (7):1174.
Safrany et al. (2007) Characterisation of a bis (5'-nucleosyl)-tetraphosphatase (asymmetrical) from Drosophila melanogaster. Int. J. Biochem. Cell Biol. 39 (5):943.
Leslie et al. (2002) Cloning and characterisation of hAps1 and hAps2, human diadenosine polyphosphate-metabolising Nudix hydrolases. BMC Biochemistry 3:20.
Ortiz et al. (1993) Specific synthesis of adenosine (5')tetraphospho (5')nucleoside and adenosine- (5')oligophospho (5')adenosine (n-greaterthan- 4) catalyzed by firefly luciverase. Eur. J. Biochem. 212 (1):263.
Palfi et al. (1991) Alterations in the accumulation of adenylylated nucleotides in heavy-metal-ion-stressed and heat-stressed Synechococcus sp strain pcc-6301, a cyanobacterium, in light and dark. Biochem. J. 276:487.
Brevet et al. (1991) Isolation and characterization of a dinucleoside triphosphatase from Saccharomyces-cerevisiae. J. Bacteriol. 173 (17):5275.
Sillero et al. (1991) Synthesis of dinucleoside polyphosphates catalyzed by firefly luciferase. Eur. J. Biochem. 202 (2):507.
Avila et al. (1991) A paradoxical increase of a metabolite upon increased expression of its catabolic enzyme - the case of diadenosine tetraphosphate (AP4A) and AP4A phosphorylase-I in Saccharomyces-cerevisiae. J. Bacteriol. 173 (24):7875.
Barnes et al. (1984) Measurement of AP4A and AP4G during the cell-cycle of Physarumpolycephalum. H-S Z. Physiol. Chem. 365 (6):608.
Bochner et al. (1984) AppppA and related adenylylated nucleotides are synthesized as a consequence of oxidation stress. Cell 37 (1):225.
Garrison et al. (1984) Assay of adenosine 5'-P1-tetraphospho-P4-5'''-adenosine and adenosine 5'-P1-tetraphospho-P4-5'''-guanosine in Physarum-polycephalum and other eukaryotes - an isocratic high-pressure liquid-chromatography method. Biochem. J. 217 (3):805.
| Cat. No. | Amount | Price |
|---|---|---|
| NU-503S | 50 μl (10 mM) | 157,60 € |
| NU-503L | 5 x 50 μl (10 mM) | 461,30 € |
At this point, external content from bioz.com is embedded. When it loads, data (e.g. your IP address) is transmitted to the provider.
Scientific citations for Jena Bioscience nu-503
6 scientific citations and 0 citation images found by Bioz.
-
Molecular basis for noncanonical transcription initiation from Np 4 A alarmones.
Nature Chemical Biology, 2026-06-04 · PMID:41094128
Abstract: Stress-induced dinucleoside tetraphosphates (Np 4 Ns, where N is adenosine, guanosine, cytosine or uridine) are ubiquitous in living organisms, yet their function has been largely elusive for over 50 years. Recent studies have revealed that RNA polymerase can influence the cellular lifetime of transcripts by incorporating these alarmones into RNA as 5'-terminal caps. Here we present structural and biochemical data that reveal the molecular basis of noncanonical transcription initiation from Np 4 As by Escherichia coli and Thermus thermophilus RNA polymerases
-
Molecular insight into 5' RNA capping with Np n Ns by bacterial RNA polymerase.
Nature Chemical Biology, 2026-01-09 · PMID:41513851
Ap4G purification for the cryo-EM study To prevent contamination of the Ap4G standard by pppApG, we treated
Ap4G and pppApG standard (used as a control,Jena Bioscience ) with 1 U of nuclease P1 (NEB) in 1× buffer (50 mM ammonium acetate, pH 5.3) for 30 min at 37 °C followed by treatment with 0.03 U of shrimp alkaline phosphatase (NEB) in 1× rCutSmart buffer (50 mM potassium acetate, 20 mM Tris acetate, 10 mM magnesium acetate and 100 μg ml−1 recombinant albumin, pH 7.9 at 25 °C) and incubated for 10 min at 37 °C. -
Molecular basis for non-canonical transcription initiation from Np 4 A alarmones
Nature Chemical Biology, 2025-10-15 · PMID:41094128
GCACAGTACCACCTTTTTTGCACCAGCAAAAGTGCGAATACCACTTGACAGAAAGGCCCGTCGCGAGTACTTTGTCAA N ACGTTTTTTGGTGTTTTGTGTTGTTT P 1 -(5’-Adenosyl)-P 4 -(5’-uridyl)-tetraphosphate sodium salt (Ap 4 U) and Ap 4 G were from
Jena Bioscience (catalog # NU-528L andNU-503L ), Ap 4 A and NTPs were from Sigma (catalog # D1262, A2383, G8877, C1506, and U6750). To assess capping efficiency at the initial transcription steps, we
